Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04441

HP ID(1) HP04441
Gene ID(2) 7164
Gene Symbol finder TPD52L1
Protein Name tumor protein D52-like 1
RefSeq NM_003287.2
Length of RefSeq (bp) 1388
Chromosome 6q22-q23
Reference DDBJ accession
UniGene Hs.591347

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe39C05 pKA1U5 GGCCAGGAGTGGGAGCGAGCGGCGGGGCCAGCTGCGTTCTGAGCCTGGGCGCAGCTGCCA
ARe78G12 pKA1U5 GAGGAGTGGGAGCGAGCGGCGGGGCCAGCTGCCTTNTGAGCCTGGGCGCAGCTGCCATCT
ARiS023O11 pGCAP10 GGACACGCNNNCCAGGAGTGGGAGCGAGCGGCGGGGCCAGCTGCGTTCTGAGCCTGGGCG
ARiS122A11 pGCAP10 GGTGGACTGGAAGGGGCGGAGGTAACCAGAAGCGGCTAGTGGCGGCTGCCTGCGTCCCCA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl