Prev. | 

RIKEN DNA Bank Human Resource - TPD52L1

Gene ID NCBI Gene 7164 |  KEGG hsa:7164
Gene Symbol TPD52L1
Protein Name TPD52 like 1
Synonyms D53
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080635 IRAL001J19 pOTB7 BC002375 NM_001003396 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR055653 ARe39C05 pKA1U5 NM_003287.2  
GGCCAGGAGTGGGAGCGAGCGGCGGGGCCAGCTGCGTTCTGAGCCTGGGCGCAGCTGCCA
HKR071356 ARe78G12 pKA1U5 NM_003287.2  
GAGGAGTGGGAGCGAGCGGCGGGGCCAGCTGCCTTNTGAGCCTGGGCGCAGCTGCCATCT
HKR209547 ARiS023O11 pGCAP10 NM_003287.2  
GGACACGCNNNCCAGGAGTGGGAGCGAGCGGCGGGGCCAGCTGCGTTCTGAGCCTGGGCG
HKR248811 ARiS122A11 pGCAP10 NM_003287.2  
GGTGGACTGGAAGGGGCGGAGGTAACCAGAAGCGGCTAGTGGCGGCTGCCTGCGTCCCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl