Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04423

HP ID(1) HP04423
Gene ID(2) 29100
Gene Symbol finder TMEM208
Protein Name transmembrane protein 208
RefSeq NM_014187.3
Length of RefSeq (bp) 808
Chromosome 16q22.1
Reference DDBJ accession
UniGene Hs.433203

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe92H02 pKA1U5 GGCGGATTTCGGTCGCTCTCCCGTGATTTCCCGGGCTGGGTATTTGCCTCGCACCATGGC
ARiS118P05 pGCAP10 GAAGTGCATGAGCTGCCGATGTGGTGCTTAGTGATTGCGGTTTCGGTCGCTCTCCCGTGT
RBd61F04 pGCAP10 TTTTTTTTTTTTTTTTTTGCCTCGCACCATGGCGCCCAAGGGCAAAGTGGGCACGAGAGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl