Prev. | 

RIKEN DNA Bank Human Resource - TMEM208

Gene ID NCBI Gene 29100 |  KEGG hsa:29100
Gene Symbol TMEM208
Protein Name transmembrane protein 208
Synonyms HSPC171
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081488 IRAL003L24 pOTB7 BC003080 NM_014187
HGY084042 IRAL010B18 pOTB7 BC013412 NM_014187 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE100019 M01C050A19 pDONR221 MGC14-E10 BC003080 NM_014187  
HGE100067 M01C050C19 pDONR221 MGC14-E10 BC003080 NM_014187  
HGE100115 M01C050E19 pDONR221 MGC14-E10 BC003080 NM_014187  
HGE100163 M01C050G19 pDONR221 MGC14-E10 BC003080 NM_014187  
HGE100211 M01C050I19 pDONR221 MGC14-E10 BC003080 NM_014187  
HGE100259 M01C050K19 pDONR221 MGC14-E10 BC003080 NM_014187  
HGE100307 M01C050M19 pDONR221 MGC14-E10 BC003080 NM_014187  
HGE100355 M01C050O19 pDONR221 MGC14-E10 BC003080 NM_014187  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR076970 ARe92H02 pKA1U5 NM_014187.3  
GGCGGATTTCGGTCGCTCTCCCGTGATTTCCCGGGCTGGGTATTTGCCTCGCACCATGGC
HKR247565 ARiS118P05 pGCAP10 NM_014187.3  
GAAGTGCATGAGCTGCCGATGTGGTGCTTAGTGATTGCGGTTTCGGTCGCTCTCCCGTGT
HKR384524 RBd61F04 pGCAP10 NM_014187.3  
TTTTTTTTTTTTTTTTTTGCCTCGCACCATGGCGCCCAAGGGCAAAGTGGGCACGAGAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl