Prev. | NRCD Clone R | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04417

HP ID(1) HP04417
Gene ID(2) 89970
Gene Symbol finder RSPRY1
Protein Name ring finger and SPRY domain containing 1
RefSeq NM_133368.1
Length of RefSeq (bp) 2084
Chromosome 16q13
Reference DDBJ accession
UniGene Hs.460885

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARi57E11 pGCAP10 ACGAAGCGGGGGTGGGCTCTGCGCGTAATGGCAGCGCCGTGGCCTCGCGTCCATCTTTGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl