Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04416

HP ID(1) HP04416
Gene ID(2) 7039
Gene Symbol finder TGFA
Protein Name transforming growth factor, alpha
RefSeq NM_003236.2
Length of RefSeq (bp) 4264
Chromosome 2p13
Reference DDBJ accession
UniGene Hs.170009

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe96B02 pKA1U5 GACTCGGGCACCGCAGGTAGGGCAGGAGGCTGGAGAGCCTGCTGCCCGCCCGCCCGTAAA
ARi67B05 pGCAP10 GACTCGGGCACCGCAGGTAGGGCAGGAGGCTGGAGAGCCTGCTGCCCGCCCGCCCGTAAA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl