Prev. |  KEGG KO K08774 > 

RIKEN DNA Bank Human Resource - TGFA

Gene ID NCBI Gene 7039 |  KEGG hsa:7039
Gene Symbol TGFA
Protein Name transforming growth factor alpha
Synonyms TFGA
Ortholog resource in our bank

  TGFA

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB05283 pAxCALNLhTGFA(forward) Shuttle vector to generate rAd expressing human TGFA
RDB05284 pAxCALNLhTGFA(reverse) Shuttle vector to generate rAd expressing human TGFA
RDB07348 pGL4-phTGFA Promoter collection, Human TGFA promoter

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY086659 IRAL016K19 pDNR-LIB BC005308 NM_003236 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE023395 W01A058I03 pENTR-TOPO IRAL016K19 BC005308 NM_003236  
HGE023397 W01A058I05 pENTR-TOPO IRAL016K19 BC005308 NM_003236  
HGE023399 W01A058I07 pENTR-TOPO IRAL016K19 BC005308 NM_003236  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2022Apr03.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR078426 ARe96B02 pKA1U5 NM_003236.2  
GACTCGGGCACCGCAGGTAGGGCAGGAGGCTGGAGAGCCTGCTGCCCGCCCGCCCGTAAA
HKR186829 ARi67B05 pGCAP10 NM_003236.2  
GACTCGGGCACCGCAGGTAGGGCAGGAGGCTGGAGAGCCTGCTGCCCGCCCGCCCGTAAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.05.18

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl