Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04408

HP ID(1) HP04408
Gene ID(2) 808
Gene Symbol finder CALM3
Protein Name calmodulin 3 (phosphorylase kinase, delta)
RefSeq NM_005184.2
Length of RefSeq (bp) 2277
Chromosome 19q13.2-q13.3
Reference DDBJ accession
UniGene Hs.515487

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe42A10 pKA1U5 TGGAGGGACCGTTGGGGCGGGAGGCGGCGGCGGCGGCGGCGCGCGCTGCGGGCAGTGAGT
ARiS020A05 pGCAP10 TGGGGGCGCGCGCGGCGGCCGTTGAGGGACCGTTGGGGCGGGAGGCGGCGGCGGCAANAN
ARiS045A14 pGCAP10 GGGAACTGCTGCAGCTGCTGCCGCCGCCGGAGGAACCTTGATCCCCGTGCTCCGGACACC
ARiS085N15 pGCAP10 GGTGGAGGCGCGGACGCGCGGCGGAGCTGGAACTGCTGCAGCTGCTGCCGCCGCCGGAGG
RBb33D06 pGCAP1 GTGTTGGGTGTGGAGGCGCGGACGCGCGGCGGAGCTGGAACTGCTGCAGCTGCTGCCGCC
RBd21B07 pGCAP10 GGAGCGAGGCGGGGCGCGCGCGGCGGCCGTTGAGGGACCGTTGGGGCGGGAGGCGGCGGC
RBd29H10 pGCAP10 GGGGGCGGGAGGCGGCGGCGGCGGCGGCGCGCGCTGCGGGCAGTGAGTGTGGAGGCGCGG
RBd68D06 pGCAP10 GGAGCCNGGCGGGGCGCGCGCGNNNNNCGTTGAGGGACCGTTGGNGNGGGAGGCGGCGGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl