Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04405

HP ID(1) HP04405
Gene ID(2) 5771
Gene Symbol finder PTPN2
Protein Name protein tyrosine phosphatase, non-receptor type 2
RefSeq NM_080423.1
Length of RefSeq (bp) 1623
Chromosome 18p11.3-p11.2
Reference DDBJ accession
UniGene Hs.654527

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARa34H02 pKA1U5 GCCCGGATCGTGCGGGGCCTGAGCCTCTCCGCCGGCGCAGGCTCTGCTCGCGCCAGCTCG
RBd89E08 pGCAP10 GGATCGTGCGGGGCCTGAGCCTCTCCGCCGGCGCAGGCTCTGCTCGCGCCAGCTCGCTCC
RBdS104K20 pGCAP10 GGGATCGTGCGGGGCCTGAGCCTCTCCGCCGGCGCAGGCTCTGCTCGCGCCAGCTCGCTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl