DNA Bank Top |  KEGG KO K18026 > 

RIKEN DNA Bank Human Resource - PTPN2

Gene ID NCBI Gene 5771 |  KEGG hsa:5771
Gene Symbol PTPN2
Protein Name protein tyrosine phosphatase non-receptor type 2
Synonyms PTN2|PTPT|TC-PTP|TCELLPTP|TCPTP
Featured content Jak-STAT signaling pathway (human)

Link

Ortholog resource in our bank

  PTPN2

External database

human PTPN2

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB05362 pAxCALNLhMAP2K6/MEK6 (reverse) Shuttle vector to generate rAd harboring human MAP2K6/MEK6 (reverse)    
RDB05361 pAxCALNLhMAP2K6/MEK6 (forward) Shuttle vector to generate rAd harboring human MAP2K6/MEK6 (forward)    
RDB05352 pAxCALNLhPTPN2 (forward) Shuttle vector to generate rAd harboring human PTPN2 (forward)    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005484 IRAK013L20 pCMV-SPORT6 BC008244 NM_080422 Full
HGY093060 IRAL032K20 pDNR-LIB BC016727 NM_080423 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR013770 ARa34H02 pKA1U5 NM_080423.1  
GCCCGGATCGTGCGGGGCCTGAGCCTCTCCGCCGGCGCAGGCTCTGCTCGCGCCAGCTCG
HKR395704 RBd89E08 pGCAP10 NM_080423.1  
GGATCGTGCGGGGCCTGAGCCTCTCCGCCGGCGCAGGCTCTGCTCGCGCCAGCTCGCTCC
HKR441860 RBdS104K20 pGCAP10 NM_080423.1  
GGGATCGTGCGGGGCCTGAGCCTCTCCGCCGGCGCAGGCTCTGCTCGCGCCAGCTCGCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

2024.09.27

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl