Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04402

HP ID(1) HP04402
Gene ID(2) 8301
Gene Symbol finder PICALM
Protein Name phosphatidylinositol binding clathrin assembly protein
RefSeq NM_007166.2
Length of RefSeq (bp) 3860
Chromosome 11q14
Reference DDBJ accession
UniGene Hs.163893

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb32A08 pGCAP1 GCCGCCATTTTCCTGCAGCTGCCTGTTCCTCTTACCCTGCCCGGCTCCAGCTGACCAGGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl