Prev. |  KEGG KO K20044 > 

RIKEN DNA Bank Human Resource - PICALM

Gene ID NCBI Gene 8301 |  KEGG hsa:8301
Gene Symbol PICALM
Protein Name phosphatidylinositol binding clathrin assembly protein
Synonyms CALM|CLTH|LAP
Ortholog resource in our bank

  PICALM

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX037550 IRAK093O14 pCMV-SPORT6 BC048259 NM_007166 Full
HGX053970 IRAK134P10 pCMV-SPORT6 BC064357 NM_001008660 Full
HGX069899 IRAK174M11 pCMV-SPORT6 BC073961 NM_001008660 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE041312 W01A103E16 pENTR-TOPO IRAK134P10 BC064357 NM_001008660  
HGE041318 W01A103E22 pENTR-TOPO IRAK134P10 BC064357 NM_001008660  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR332808 RBb32A08 pGCAP1 NM_007166.2  
GCCGCCATTTTCCTGCAGCTGCCTGTTCCTCTTACCCTGCCCGGCTCCAGCTGACCAGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl