Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04384

HP ID(1) HP04384
Gene ID(2) 7703
Gene Symbol finder PCGF2
Protein Name polycomb group ring finger 2
RefSeq NM_007144.2
Length of RefSeq (bp) 2622
Chromosome 17q12
Reference DDBJ accession
UniGene Hs.371617

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe88A05 pKA1U5 GGCTGGTGTGGCTGCAGGCTCGAGCTGGGGTCACTCGGCGGCCAGTGTGCGCAGGTCTCC
RBb45H10 pGCAP1 TGCCCCCCCACACTCCGGTCCCTCCCCTCCCCCCTCGGTCCCCTCCCCTCCCCTCTCCCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl