Prev. |  KEGG KO K11460 > 

RIKEN DNA Bank Human Resource - PCGF2

Gene ID NCBI Gene 7703 |  KEGG hsa:7703
Gene Symbol PCGF2
Protein Name polycomb group ring finger 2
Synonyms MEL-18|RNF110|TPFS|ZNF144
Featured content Signaling pathways regulating pluripotency of stem cells (human)
Ortholog resource in our bank

  PCGF2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY085303 IRAL013E07 pOTB7 BC024255 NM_007144 Full
HGY085850 IRAL014K10 pOTB7 BC004858 NM_007144 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR075205 ARe88A05 pKA1U5 NM_007144.2  
GGCTGGTGTGGCTGCAGGCTCGAGCTGGGGTCACTCGGCGGCCAGTGTGCGCAGGTCTCC
HKR338178 RBb45H10 pGCAP1 NM_007144.2  
TGCCCCCCCACACTCCGGTCCCTCCCCTCCCCCCTCGGTCCCCTCCCCTCCCCTCTCCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl