Prev. | Human A to Z list > P > 

RIKEN DNA Bank Human Resource - PCGF2

Gene ID (NCBI) 7703
Gene Symbol PCGF2
Protein Name polycomb group ring finger 2
Synonyms MEL-18|RNF110|ZNF144
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Signaling pathways regulating pluripotency of stem cells (human)


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY085303 IRAL013E07 pOTB7 BC024255 NM_007144 Full
HGY085850 IRAL014K10 pOTB7 BC004858 NM_007144 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR075205 ARe88A05 pKA1U5 NM_007144.2
GGCTGGTGTGGCTGCAGGCTCGAGCTGGGGTCACTCGGCGGCCAGTGTGCGCAGGTCTCC
HKR338178 RBb45H10 pGCAP1 NM_007144.2
TGCCCCCCCACACTCCGGTCCCTCCCCTCCCCCCTCGGTCCCCTCCCCTCCCCTCTCCCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.03

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl