Prev. | NRCD Clone W | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04381

HP ID(1) HP04381
Gene ID(2) 55093
Gene Symbol finder WDYHV1
Protein Name WDYHV motif containing 1
RefSeq NM_018024.1
Length of RefSeq (bp) 1348
Chromosome 8q24.13
Reference DDBJ accession
UniGene Hs.18029

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe53G01 pKA1U5 GCCTTTCCTACGTCTGGTCCAGTCGGTCTTCCTCCGGCCCGGGCCCTGGCCCAGCTAGCC
ARiS122I23 pGCAP10 GTTCCTCCGGCCCGGGCCCTGGCCCAGCTAGCCGGCCATGGAAGGTAATGGCCCCGCTGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl