Prev. |  KEGG KO K21286 > 

RIKEN DNA Bank Human Resource - WDYHV1

Gene ID NCBI Gene 55093 |  KEGG hsa:55093
Gene Symbol WDYHV1
Protein Name WDYHV motif containing 1
Synonyms C8orf32
Ortholog resource in our bank

  WDYHV1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY085105 IRAL012M17 pOTB7 BC008781 NM_018024 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR061345 ARe53G01 pKA1U5 NM_018024.1  
GCCTTTCCTACGTCTGGTCCAGTCGGTCTTCCTCCGGCCCGGGCCCTGGCCCAGCTAGCC
HKR249015 ARiS122I23 pGCAP10 NM_018024.1  
GTTCCTCCGGCCCGGGCCCTGGCCCAGCTAGCCGGCCATGGAAGGTAATGGCCCCGCTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl