Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04378

HP ID(1) HP04378
Gene ID(2) 84270
Gene Symbol finder C9orf89
Protein Name chromosome 9 open reading frame 89
RefSeq NM_032310.3
Length of RefSeq (bp) 922
Chromosome 9q22.31
Reference DDBJ accession
UniGene Hs.434213

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe07G05 pKA1U5 GGGGCGGCGTTCGCTGGAGCTGGTGGACCGGGCGGCTGACCGAGGGGCGGACGCGCGGCG
ARi57G05 pGCAP10 GACGGCCCGCGGGCGGCGTTCGCTGGAGCTGGTGGACCGGGCGGCTGACCGAGGGGCGGA
RBd63C03 pGCAP10 GGGGCGGCGTTCGCTGGAGCTGGTGGACCGGGCGGCTGACCGAGGGGCGGACGCGCGGCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl