Prev. | 

RIKEN DNA Bank Human Resource - CARD19

Gene ID NCBI Gene 84270 |  KEGG hsa:84270
Gene Symbol CARD19
Protein Name caspase recruitment domain family member 19
Synonyms BinCARD|C9orf89
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX031349 IRAK078G05 pCMV-SPORT6 BC042201 NM_032310 Partial/var
HGX032914 IRAK082E18 pCMV-SPORT6 BC038856 NM_032310
HGY085639 IRAL014B15 pOTB7 BC004500 NM_032310 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042949 ARe07G05 pKA1U5 NM_032310.3  
GGGGCGGCGTTCGCTGGAGCTGGTGGACCGGGCGGCTGACCGAGGGGCGGACGCGCGGCG
HKR182949 ARi57G05 pGCAP10 NM_032310.3  
GACGGCCCGCGGGCGGCGTTCGCTGGAGCTGGTGGACCGGGCGGCTGACCGAGGGGCGGA
HKR385251 RBd63C03 pGCAP10 NM_032310.3  
GGGGCGGCGTTCGCTGGAGCTGGTGGACCGGGCGGCTGACCGAGGGGCGGACGCGCGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl