Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04366

HP ID(1) HP04366
Gene ID(2) 113452
Gene Symbol finder TMEM54
Protein Name transmembrane protein 54
RefSeq NM_033504.2
Length of RefSeq (bp) 1063
Chromosome 1p35-p34
Reference DDBJ accession
UniGene Hs.534521

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe96E03 pKA1U5 GGGTCCGGCGCCGCCCAGCCCCGGGCTCCGGGCGGGAAGTGGGCGAGCGCGACGGTGCGG
ARi57B06 pGCAP10 GGGGAAGGGAGGCCGGTCCGGCGCCGCCCAGCCCCGGGCTCCGGGCGGGAAGTGGGCGAG
ARiS013H22 pGCAP10 AGGCCCAGCCCCGGGCTCCGGGCGGGAAGTGGGCGAGCGCGACGGTGCGGGGCGCGCGGG
RBdS070G23 pGCAP10 CGGCCGGCCGATGGCCGCCCANCCCCGGGCTCCGGGCGGGAAGTGGGCGAGCGCGACGGT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl