Prev. | 

RIKEN DNA Bank Human Resource - TMEM54

Gene ID NCBI Gene 113452 |  KEGG hsa:113452
Gene Symbol TMEM54
Protein Name transmembrane protein 54
Synonyms BCLP|CAC-1|CAC1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX011621 IRAK029A21 pCMV-SPORT6 BC023260 NM_033504 Full/var
HGY081373 IRAL003H05 pOTB7 BC013953 NM_033504 Full
HGY081816 IRAL004I24 pOTB7 BC001418 NM_033504

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR078499 ARe96E03 pKA1U5 NM_033504.2  
GGGTCCGGCGCCGCCCAGCCCCGGGCTCCGGGCGGGAAGTGGGCGAGCGCGACGGTGCGG
HKR182830 ARi57B06 pGCAP10 NM_033504.2  
GGGGAAGGGAGGCCGGTCCGGCGCCGCCCAGCCCCGGGCTCCGGGCGGGAAGTGGGCGAG
HKR205390 ARiS013H22 pGCAP10 NM_033504.2  
AGGCCCAGCCCCGGGCTCCGGGCGGGAAGTGGGCGAGCGCGACGGTGCGGGGCGCGCGGG
HKR428167 RBdS070G23 pGCAP10 NM_033504.2  
CGGCCGGCCGATGGCCGCCCANCCCCGGGCTCCGGGCGGGAAGTGGGCGAGCGCGACGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl