Prev. | NRCD Clone C | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04365

HP ID(1) HP04365
Gene ID(2) 79161
Gene Symbol finder C7orf23
Protein Name chromosome 7 open reading frame 23
RefSeq NM_024315.2
Length of RefSeq (bp) 1083
Chromosome 7q21.1-q21.2
Reference DDBJ accession
UniGene Hs.196129

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe29G07 pKA1U5 GGAGAAGGAGCCGGGAGGTGATCCGCAGCGCTGCGACGGGACCGCGCGATTCCTCTCCCA
ARe53F06 pKA1U5 GAGCGGGTCCGGGTCGGGGGACCTGAGAAGGAGCCGGGAGGTGATCCGCAGCGCTGCGAC
ARe93F05 pKA1U5 GACTTCCTGCGGCAGCTGCTCAAGATGAGGAGGTGCGCGGGGCCGGGGCGGAGCAGTCGC
RBd83A04 pGCAP10 TGGGGGGACCTGAGAAGGAGCCGGGAGGTGATCCGCAGCGCTGCGACGGGACCGCGCGAT
RBdS013J17 pGCAP10 GGCAGCGGGTCCGGGTCGGGGGACCTGAGAAGGAGCCGGGAGGTGATCCGCAGCGCTGCG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl