Prev. | 

RIKEN DNA Bank Human Resource - TMEM243

Gene ID NCBI Gene 79161 |  KEGG hsa:79161
Gene Symbol TMEM243
Protein Name transmembrane protein 243
Synonyms C7orf23|MM-TRAG|MMTRAG
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY085070 IRAL012L06 pOTB7 BC002837 NM_024315

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE003626 W01A009B02 pENTR-TOPO IRAL012L06 BC002837 NM_024315  
HGE003630 W01A009B06 pENTR-TOPO IRAL012L06 BC002837 NM_024315  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR051751 ARe29G07 pKA1U5 NM_024315.2  
GGAGAAGGAGCCGGGAGGTGATCCGCAGCGCTGCGACGGGACCGCGCGATTCCTCTCCCA
HKR061326 ARe53F06 pKA1U5 NM_024315.2  
GAGCGGGTCCGGGTCGGGGGACCTGAGAAGGAGCCGGGAGGTGATCCGCAGCGCTGCGAC
HKR077325 ARe93F05 pKA1U5 NM_024315.2  
GACTTCCTGCGGCAGCTGCTCAAGATGAGGAGGTGCGCGGGGCCGGGGCGGAGCAGTCGC
HKR393204 RBd83A04 pGCAP10 NM_024315.2  
TGGGGGGACCTGAGAAGGAGCCGGGAGGTGATCCGCAGCGCTGCGACGGGACCGCGCGAT
HKR405433 RBdS013J17 pGCAP10 NM_024315.2  
GGCAGCGGGTCCGGGTCGGGGGACCTGAGAAGGAGCCGGGAGGTGATCCGCAGCGCTGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl