Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04349

HP ID(1) HP04349
Gene ID(2) 5715
Gene Symbol finder PSMD9
Protein Name proteasome (prosome, macropain) 26S subunit, non-ATPase, 9
RefSeq NM_002813.4
Length of RefSeq (bp) 2360
Chromosome 12q24.31-q24.32
Reference DDBJ accession
UniGene Hs.131151

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARa28A10 pKA1U5 ATCCTGGGCGGCCCGGGGTTCACGATGTCCGACGAGCGAANCGAGGCAGAGCGGAGGCTC
RBb36G01 pGCAP1 GAGAGCGGAGGCTCCTCGCAGGCCGGCGCCGTGACTGTCAGCGACGTCCAGGAGCTGATG
RBb49H11 pGCAP1 GGGGGCGTCGTCCCTAGCCCGGGAGCCGGGTCTCTGGAGTCGCGGCCCGGGGTTCACGAT
RBd16B12 pGCAP10 GGCGGCCCGGGGTTCACGATGTCCGACGAGGAAGCGAGGCAGAGCGGAGGCTCCTCGCAG
RBd87B12 pGCAP10 GGCCGGGTCTCTGGAGTCGCGGCCCGGGGTTCACGATGTCCGACGAGGAAGCGAGGCAGA
RBdS051F05 pGCAP10 GAGTCGCGGCCCGGGGTTCACGATGTCCGACGAGGAAGCGAGGCAGAGCGGAGGCTCCTC
RBdS156D06 pGCAP10 GAGTCGCGGCCCGGGGTTCACGATGTCCGACGAGGAAGCGAGGCAGAGCGGAGGCTCCTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl