Prev. |  KEGG KO K06693 > 

RIKEN DNA Bank Human Resource - PSMD9

Gene ID NCBI Gene 5715 |  KEGG hsa:5715
Gene Symbol PSMD9
Protein Name proteasome 26S subunit, non-ATPase 9
Synonyms Rpn4|p27
Ortholog resources KEGG ortholog (KEGG orthology K06693) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080723 IRAL001N11 pOTB7 BC002383 NM_002813 Full
HGY081074 IRAL002L10 pOTB7 BC004184 NM_002813 Full
HGY084175 IRAL010H07 pOTB7 BC004213 NM_002813 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR011210 ARa28A10 pKA1U5 NM_002813.4  
ATCCTGGGCGGCCCGGGGTTCACGATGTCCGACGAGCGAANCGAGGCAGAGCGGAGGCTC
HKR334545 RBb36G01 pGCAP1 NM_002813.4  
GAGAGCGGAGGCTCCTCGCAGGCCGGCGCCGTGACTGTCAGCGACGTCCAGGAGCTGATG
HKR339779 RBb49H11 pGCAP1 NM_002813.4  
GGGGGCGTCGTCCCTAGCCCGGGAGCCGGGTCTCTGGAGTCGCGGCCCGGGGTTCACGAT
HKR366436 RBd16B12 pGCAP10 NM_002813.4  
GGCGGCCCGGGGTTCACGATGTCCGACGAGGAAGCGAGGCAGAGCGGAGGCTCCTCGCAG
HKR394836 RBd87B12 pGCAP10 NM_002813.4  
GGCCGGGTCTCTGGAGTCGCGGCCCGGGGTTCACGATGTCCGACGAGGAAGCGAGGCAGA
HKR420525 RBdS051F05 pGCAP10 NM_002813.4  
GAGTCGCGGCCCGGGGTTCACGATGTCCGACGAGGAAGCGAGGCAGAGCGGAGGCTCCTC
HKR462478 RBdS156D06 pGCAP10 NM_002813.4  
GAGTCGCGGCCCGGGGTTCACGATGTCCGACGAGGAAGCGAGGCAGAGCGGAGGCTCCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl