Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04329

HP ID(1) HP04329
Gene ID(2) 51082
Gene Symbol finder POLR1D
Protein Name polymerase (RNA) I polypeptide D, 16kDa
RefSeq NM_015972.2
Length of RefSeq (bp) 725
Chromosome 13q12.2
Reference DDBJ accession
UniGene Hs.507584

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe12A06 pKA1U5 GACTCTCGCCCCGGGCTGTCCCCGCCGCCCGCCTGATTCCCCTGCGGAAGCCCCGCTGGC
ARe14E01 pKA1U5 GCCTTCCTTCCTGCTTCGCCTCCGCGCCTCGCGCTATGGGACAGAGCCCCCGATCCGCCA
ARe96F04 pKA1U5 GCTTCCGTCCTCCGCGCCTTCCGTCGGTCGGTCCTTCCTTCCTGCTTCGCCTCCGCGCCT
ARf06G10 pKA1U5 ATCCTGGCCTTCCTGCTTCGCCTCCGCGCCTCGCGCTATGGGACAGAGCCCCCGATCCGC
ARi46G11 pGCAP10 GGCGCCTTCCGTCGGTCGGTCCTTGCTTCCTGCTTCGCCTCCGCGCCTCGCGCTATGGGA
ARiS087J02 pGCAP10 GCCTTCCTTCCTGCTTCGCCTCCGCGCCTCGCGCTATGGGACAGAGCCCCCGATCCGCCA
ARiS088N02 pGCAP10 GCTTCCTGCTTCGCCTCCGCGCCTCGCGCTATGGGACAGAGCCCCCGATCCGCCAGCACC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl