Prev. |  KEGG KO K03020 > 

RIKEN DNA Bank Human Resource - POLR1D

Gene ID NCBI Gene 51082 |  KEGG hsa:51082
Gene Symbol POLR1D
Protein Name RNA polymerase I subunit D
Synonyms AC19|POLR1C|RPA16|RPA9|RPAC2|RPC16|RPO1-3|TCS2
Ortholog resources KEGG ortholog (KEGG orthology K03020) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001738 IRAK004F18 pCMV-SPORT6 BC000889 NM_015972 Full
HGX044139 IRAK110F19 pCMV-SPORT6 BC054519 NM_015972 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE011105 W01A027M17 pENTR-TOPO IRAK004F18 BC000889 NM_015972  
HGE011107 W01A027M19 pENTR-TOPO IRAK004F18 BC000889 NM_015972  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR044806 ARe12A06 pKA1U5 NM_015972.2  
GACTCTCGCCCCGGGCTGTCCCCGCCGCCCGCCTGATTCCCCTGCGGAAGCCCCGCTGGC
HKR045697 ARe14E01 pKA1U5 NM_015972.2  
GCCTTCCTTCCTGCTTCGCCTCCGCGCCTCGCGCTATGGGACAGAGCCCCCGATCCGCCA
HKR078524 ARe96F04 pKA1U5 NM_015972.2  
GCTTCCGTCCTCCGCGCCTTCCGTCGGTCGGTCCTTCCTTCCTGCTTCGCCTCCGCGCCT
HKR082554 ARf06G10 pKA1U5 NM_015972.2  
ATCCTGGCCTTCCTGCTTCGCCTCCGCGCCTCGCGCTATGGGACAGAGCCCCCGATCCGC
HKR178555 ARi46G11 pGCAP10 NM_015972.2  
GGCGCCTTCCGTCGGTCGGTCCTTGCTTCCTGCTTCGCCTCCGCGCCTCGCGCTATGGGA
HKR235018 ARiS087J02 pGCAP10 NM_015972.2  
GCCTTCCTTCCTGCTTCGCCTCCGCGCCTCGCGCTATGGGACAGAGCCCCCGATCCGCCA
HKR235514 ARiS088N02 pGCAP10 NM_015972.2  
GCTTCCTGCTTCGCCTCCGCGCCTCGCGCTATGGGACAGAGCCCCCGATCCGCCAGCACC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl