Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04321

HP ID(1) HP04321
Gene ID(2) 79717
Gene Symbol finder PPCS
Protein Name phosphopantothenoylcysteine synthetase
RefSeq NM_024664.2
Length of RefSeq (bp) 1489
Chromosome 1p34.2
Reference DDBJ accession
UniGene Hs.710166

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe19E05 pKA1U5 GGCAGATGGCGGAAATGGATCCGGTAGCCGAGTTCCCCCAGCCTCCCGGTGCTGCGCGCT
ARiS023M16 pGCAP10 GGCTGCAGATGGCGGAAATGGATCCGGTAGCCGAGTTCCCCCAGCCTCCCGGTGCTGCGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl