Prev. |  KEGG KO K01922 > 

RIKEN DNA Bank Human Resource - PPCS

Gene ID NCBI Gene 79717 |  KEGG hsa:79717
Gene Symbol PPCS
Protein Name phosphopantothenoylcysteine synthetase
Synonyms CMD2C
Ortholog resources KEGG ortholog (KEGG orthology K01922) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX054201 IRAK135I09 pCMV-SPORT6 BC062586 NM_024664 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR047701 ARe19E05 pKA1U5 NM_024664.2  
GGCAGATGGCGGAAATGGATCCGGTAGCCGAGTTCCCCCAGCCTCCCGGTGCTGCGCGCT
HKR209504 ARiS023M16 pGCAP10 NM_024664.2  
GGCTGCAGATGGCGGAAATGGATCCGGTAGCCGAGTTCCCCCAGCCTCCCGGTGCTGCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.16

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl