Prev. | NRCD Clone K | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04320

HP ID(1) HP04320
Gene ID(2) 85294
Gene Symbol finder KRTAP2-4
Protein Name keratin associated protein 2-4
RefSeq NM_033184.2
Length of RefSeq (bp) 812
Chromosome 17q12-q21
Reference DDBJ accession
UniGene Hs.560502

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe15E09 pKA1U5 GATTCACACCTGAGAACATCCAGCTCCTCTCAACAGCCCAACCCACACCAGCCTCAGACA
ARf02B02 pKA1U5 GATTCACACCTGAGAACATCCAGCTCCTCTCAACAGCCCAACCCACACCAGCCTCAGACA

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl