Prev. | 

RIKEN DNA Bank Human Resource - KRTAP2-4

Gene ID NCBI Gene 85294 |  KEGG hsa:85294
Gene Symbol KRTAP2-4
Protein Name keratin associated protein 2-4
Synonyms KAP2.1B|KAP2.3|KAP2.4|KRTAP2-3|KRTAP2.3|KRTAP2.4
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX053685 IRAK134D13 pCMV-SPORT6 BC063625 NM_033184 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE113604 M01C084A04 pDONR221 IMS05-F02 BC063625 XM_932450  
HGE113652 M01C084C04 pDONR221 IMS05-F02 BC063625 XM_932450  
HGE113700 M01C084E04 pDONR221 IMS05-F02 BC063625 XM_932450  
HGE113748 M01C084G04 pDONR221 IMS05-F02 BC063625 XM_932450  
HGE113796 M01C084I04 pDONR221 IMS05-F02 BC063625 XM_932450  
HGE113844 M01C084K04 pDONR221 IMS05-F02 BC063625 XM_932450  
HGE113892 M01C084M04 pDONR221 IMS05-F02 BC063625 XM_932450  
HGE113940 M01C084O04 pDONR221 IMS05-F02 BC063625 XM_932450  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR046105 ARe15E09 pKA1U5 NM_033184.2  
GATTCACACCTGAGAACATCCAGCTCCTCTCAACAGCCCAACCCACACCAGCCTCAGACA
HKR080826 ARf02B02 pKA1U5 NM_033184.2  
GATTCACACCTGAGAACATCCAGCTCCTCTCAACAGCCCAACCCACACCAGCCTCAGACA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl