Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04317

HP ID(1) HP04317
Gene ID(2) 5700
Gene Symbol finder PSMC1
Protein Name proteasome (prosome, macropain) 26S subunit, ATPase, 1
RefSeq NM_002802.2
Length of RefSeq (bp) 1586
Chromosome 14q32.11
Reference DDBJ accession
UniGene Hs.356654

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe79B08 pKA1U5 GGGCCAAGGCAAGATGGGTCAAAGTCAGAGTGGTGGTCATGGTCCTGGAGGTGGCAAGAA
ARiS045B16 pGCAP10 GGGCAGCTCNAGTGNCCAAGGCAAGATGGGTCAAAGTCAGAGTGGTGGTCATGGTCCTGG
RBd39G08 pGCAP10 GGGCAGCTCAAGTGGCCAAGGCAAGATGGGTCAAAGTCAGAGTGGTGGTCATGGTCCTGG
RBd49B04 pGCAP10 AGCTCAAGTGGCCAAGGCAAGATGGGTCAAAGTCAGAGTGGTGGTCATGGTCCTGGAGGT
RBd96G07 pGCAP10 GGGTGGAGGAACTTCCGGCAGCGGCAGCTCAAGTGGCCAAGGCAAGATGGGTCAAAGTCA
RBd96H04 pGCAP10 GAATGGGGGTGGTTGAGCACCGGGGGTCGGCGAGGGCCCGCCAAGGAAGGAGCGACCGAC
RBdS105B18 pGCAP10 GAGGAACTTCCGGCAGCGGCAGCTCAAGTGGCCAAGGCAAGATGGGTCAAAGTCAGAGTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl