Prev. |  KEGG KO K03062 > 

RIKEN DNA Bank Human Resource - PSMC1

Gene ID NCBI Gene 5700 |  KEGG hsa:5700
Gene Symbol PSMC1
Protein Name proteasome 26S subunit, ATPase 1
Synonyms P26S4|S4|p56
Ortholog resources KEGG ortholog (KEGG orthology K03062) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY067087 IRAK167L23 pBluescriptR BC067741 NM_002802 Full/var
HGY080620 IRAL001J04 pOTB7 BC000512 NM_002802 Full
HGY092818 IRAL032A18 pDNR-LIB BC016368 NM_002802 Full/var
HGY103349 IRAL058G05 pOTB7 BC073818 NM_002802 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR071632 ARe79B08 pKA1U5 NM_002802.2  
GGGCCAAGGCAAGATGGGTCAAAGTCAGAGTGGTGGTCATGGTCCTGGAGGTGGCAAGAA
HKR218040 ARiS045B16 pGCAP10 NM_002802.2  
GGGCAGCTCNAGTGNCCAAGGCAAGATGGGTCAAAGTCAGAGTGGTGGTCATGGTCCTGG
HKR375752 RBd39G08 pGCAP10 NM_002802.2  
GGGCAGCTCAAGTGGCCAAGGCAAGATGGGTCAAAGTCAGAGTGGTGGTCATGGTCCTGG
HKR379628 RBd49B04 pGCAP10 NM_002802.2  
AGCTCAAGTGGCCAAGGCAAGATGGGTCAAAGTCAGAGTGGTGGTCATGGTCCTGGAGGT
HKR398551 RBd96G07 pGCAP10 NM_002802.2  
GGGTGGAGGAACTTCCGGCAGCGGCAGCTCAAGTGGCCAAGGCAAGATGGGTCAAAGTCA
HKR398572 RBd96H04 pGCAP10 NM_002802.2  
GAATGGGGGTGGTTGAGCACCGGGGGTCGGCGAGGGCCCGCCAAGGAAGGAGCGACCGAC
HKR442042 RBdS105B18 pGCAP10 NM_002802.2  
GAGGAACTTCCGGCAGCGGCAGCTCAAGTGGCCAAGGCAAGATGGGTCAAAGTCAGAGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl