Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04286

HP ID(1) HP04286
Gene ID(2) 84817
Gene Symbol finder TXNDC17
Protein Name thioredoxin domain containing 17
RefSeq NM_032731.3
Length of RefSeq (bp) 2075
Chromosome 17p13.2
Reference DDBJ accession
UniGene Hs.408236

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe31C09 pKA1U5 GAGTAGCGGCTGCACGTCGTGCCAATGGCCCGCTATGAGGAGGTGAGCGTGTCCGGCTTC
RBb36C12 pGCAP1 GAGTAGCGGCTGCACGTCGTGCCAATGGCCCGCTATGAGGAGGTGAGCGTGTCCGGCTTC
RBd39B10 pGCAP10 GGGGACCCAACCGCGGCGACCGGACGTGCACTCCTCCAGTAGCGGCTGCACGTCGTGCCA
RBdS051P22 pGCAP10 GACTCCTCCAGTAGCGGCTGCACGTCGTGCCAATGGCCCGCTATGAGGAGGTGAGCGTGT
RBdS083H04 pGCAP10 CGGCCGGCCGATGAGTAGCGGCTGCACGTCGTGCCAATGGCCCGCTATGAGGAGGTGAGC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl