Prev. | 

RIKEN DNA Bank Human Resource - TXNDC17

Gene ID NCBI Gene 84817 |  KEGG hsa:84817
Gene Symbol TXNDC17
Protein Name thioredoxin domain containing 17
Synonyms TRP14|TXNL5
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY088287 IRAL020L23 pOTB7 BC006405 NM_032731 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR052457 ARe31C09 pKA1U5 NM_032731.3  
GAGTAGCGGCTGCACGTCGTGCCAATGGCCCGCTATGAGGAGGTGAGCGTGTCCGGCTTC
HKR334460 RBb36C12 pGCAP1 NM_032731.3  
GAGTAGCGGCTGCACGTCGTGCCAATGGCCCGCTATGAGGAGGTGAGCGTGTCCGGCTTC
HKR375634 RBd39B10 pGCAP10 NM_032731.3  
GGGGACCCAACCGCGGCGACCGGACGTGCACTCCTCCAGTAGCGGCTGCACGTCGTGCCA
HKR420782 RBdS051P22 pGCAP10 NM_032731.3  
GACTCCTCCAGTAGCGGCTGCACGTCGTGCCAATGGCCCGCTATGAGGAGGTGAGCGTGT
HKR433372 RBdS083H04 pGCAP10 NM_032731.3  
CGGCCGGCCGATGAGTAGCGGCTGCACGTCGTGCCAATGGCCCGCTATGAGGAGGTGAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl