Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04285

HP ID(1) HP04285
Gene ID(2) 53938
Gene Symbol finder PPIL3
Protein Name peptidylprolyl isomerase (cyclophilin)-like 3
RefSeq NM_130906.2
Length of RefSeq (bp) 1179
Chromosome 2q33.1
Reference DDBJ accession
UniGene Hs.121076

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARa11F12 pKA1U5 CCCAAAGAAACTATAATTTTGAACCAACAGACCTCTGCTGGCATCTGCGATTGCATTTTT
RBd02F10 pGCAP10 TTAATGATAGGAAGATGAGGGGAGGAAGGAGGTGAGGCGGTAAGGGGCGTTCTCTCTCTT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl