Prev. |  KEGG KO K12734 > 

RIKEN DNA Bank Human Resource - PPIL3

Gene ID NCBI Gene 53938 |  KEGG hsa:53938
Gene Symbol PPIL3
Protein Name peptidylprolyl isomerase like 3
Synonyms CYPJ
Ortholog resources KEGG ortholog (KEGG orthology K12734) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX020956 IRAK052G12 pCMV-SPORT6 BC031679 NM_131916
HGY086168 IRAL015G24 pOTB7 BC007693 NM_131916 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR004532 ARa11F12 pKA1U5 NM_130906.2  
CCCAAAGAAACTATAATTTTGAACCAACAGACCTCTGCTGGCATCTGCGATTGCATTTTT
HKR360930 RBd02F10 pGCAP10 NM_130906.2  
TTAATGATAGGAAGATGAGGGGAGGAAGGAGGTGAGGCGGTAAGGGGCGTTCTCTCTCTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl