Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04265

HP ID(1) HP04265
Gene ID(2) 5201
Gene Symbol finder PFDN1
Protein Name prefoldin subunit 1
RefSeq NM_002622.4
Length of RefSeq (bp) 1324
Chromosome 5q31
Reference DDBJ accession
UniGene Hs.483564

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe11F08 pKA1U5 GGCTTACAGTGCACCAAGATGGCCGCCCCCGNTGGATCTAGAGCTGAAGAAGGCCTTCAC
ARe27C10 pKA1U5 TGACCAAGATGGCCGCCCCCGNTGGATCTAGAGCTGAAGAAGGCCTTCACAGAGCTTCAA
ARe42H05 pKA1U5 AAGATGGCCGCCCCCGNTGGATCTAGAGCTGAAGAAGGCCTTCACAGAGCTTCAAGCCAA
ARe44A05 pKA1U5 GGCACCAAGATGGCCGCCCCCGNTGGATCTAGAGCTGAAGAAGGCCTTCACAGAGCTTCA
ARe49D07 pKA1U5 GGCTTACAGTGCACCAAGATGGCCGCCCCCGNTGGATCTAGAGCTGAAGAAGGCCTTCAC
ARiS008M05 pGCAP10 GACTGCGCAGGCGCTNNCAGTGCACCAAGATGGCCGCCCCCGTGGATCTAGAGCTGAAGA
ARiS109I20 pGCAP10 GGCACCAAGATGGCCGCCCCCGTGGATCTAGAGCTGAAGAAGGCCTTCACAGAGCTTCAA
ARiS122I17 pGCAP10 GGCTTACAGTGCACCAAGATGGCCGCCCCCGTGGATCTAGAGCTGAAGAAGGCCTTCACA
RBdS104G08 pGCAP10 GAGGCGCTTACAGTGCACCAAGATGGCCGCCCCCGTGGATCTAGAGCTGAAGAAGGCCTT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl