Prev. |  KEGG KO K09548 > 

RIKEN DNA Bank Human Resource - PFDN1

Gene ID NCBI Gene 5201 |  KEGG hsa:5201
Gene Symbol PFDN1
Protein Name prefoldin subunit 1
Synonyms PDF|PFD1
Ortholog resources KEGG ortholog (KEGG orthology K09548) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080958 IRAL002G14 pOTB7 BC003620 NM_002622 Full
HGY084103 IRAL010E07 pOTB7 BC006202 NM_002622 Full
HGY091202 IRAL028A02 pOTB7 BC011869 NM_002622 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE000609 W01A001I17 pENTR-TOPO IRAL028A02 BC011869 NM_002622  
HGE000613 W01A001I21 pENTR-TOPO IRAL028A02 BC011869 NM_002622  
HGE000615 W01A001I23 pENTR-TOPO IRAL028A02 BC011869 NM_002622  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR044528 ARe11F08 pKA1U5 NM_002622.4  
GGCTTACAGTGCACCAAGATGGCCGCCCCCGNTGGATCTAGAGCTGAAGAAGGCCTTCAC
HKR050858 ARe27C10 pKA1U5 NM_002622.4  
TGACCAAGATGGCCGCCCCCGNTGGATCTAGAGCTGAAGAAGGCCTTCACAGAGCTTCAA
HKR056973 ARe42H05 pKA1U5 NM_002622.4  
AAGATGGCCGCCCCCGNTGGATCTAGAGCTGAAGAAGGCCTTCACAGAGCTTCAAGCCAA
HKR057605 ARe44A05 pKA1U5 NM_002622.4  
GGCACCAAGATGGCCGCCCCCGNTGGATCTAGAGCTGAAGAAGGCCTTCACAGAGCTTCA
HKR059679 ARe49D07 pKA1U5 NM_002622.4  
GGCTTACAGTGCACCAAGATGGCCGCCCCCGNTGGATCTAGAGCTGAAGAAGGCCTTCAC
HKR203493 ARiS008M05 pGCAP10 NM_002622.4  
GACTGCGCAGGCGCTNNCAGTGCACCAAGATGGCCGCCCCCGTGGATCTAGAGCTGAAGA
HKR243812 ARiS109I20 pGCAP10 NM_002622.4  
GGCACCAAGATGGCCGCCCCCGTGGATCTAGAGCTGAAGAAGGCCTTCACAGAGCTTCAA
HKR249009 ARiS122I17 pGCAP10 NM_002622.4  
GGCTTACAGTGCACCAAGATGGCCGCCCCCGTGGATCTAGAGCTGAAGAAGGCCTTCACA
HKR441752 RBdS104G08 pGCAP10 NM_002622.4  
GAGGCGCTTACAGTGCACCAAGATGGCCGCCCCCGTGGATCTAGAGCTGAAGAAGGCCTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl