Prev. | NRCD Clone P | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04258

HP ID(1) HP04258
Gene ID(2) 5575
Gene Symbol finder PRKAR1B
Protein Name protein kinase, cAMP-dependent, regulatory, type I, beta
RefSeq NM_002735.1
Length of RefSeq (bp) 1932
Chromosome 7p22
Reference DDBJ accession
UniGene Hs.520851

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARiS194A22 pGCAP10 GGGCGAAGGGGTCGAGCAGGGAGCAGCGCAGCGCGCGCAGAGCGTCGTCCAGGAAGGAAG
RBd12H10 pGCAP10 GGGGAGTGAGGTGAGTGAGGGCCAAGCAGGAACAGGGGTCACGGGGCAAGGAGCACGTGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl