Prev. |  KEGG KO K04739 > 

RIKEN DNA Bank Human Resource - PRKAR1B

Gene ID NCBI Gene 5575 |  KEGG hsa:5575
Gene Symbol PRKAR1B
Protein Name protein kinase cAMP-dependent type I regulatory subunit beta
Synonyms PRKAR1
Ortholog resources KEGG ortholog (KEGG orthology K04739) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX031457 IRAK078K17 pCMV-SPORT6 BC036828 NM_002735

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR277622 ARiS194A22 pGCAP10 NM_002735.1  
GGGCGAAGGGGTCGAGCAGGGAGCAGCGCAGCGCGCGCAGAGCGTCGTCCAGGAAGGAAG
HKR364978 RBd12H10 pGCAP10 NM_002735.1  
GGGGAGTGAGGTGAGTGAGGGCCAAGCAGGAACAGGGGTCACGGGGCAAGGAGCACGTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.12.18

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl