Prev. | NRCD Clone N | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04253

HP ID(1) HP04253
Gene ID(2) 55270
Gene Symbol finder NUDT15
Protein Name nudix (nucleoside diphosphate linked moiety X)-type motif 15
RefSeq NM_018283.1
Length of RefSeq (bp) 2022
Chromosome 13q14.2
Reference DDBJ accession
UniGene Hs.144407

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBb65F04 pGCAP1 TGGAGGCGCGTCCTCCCGTGCGCTATGACGGCCAGCGCACAGCCGCGCGGGCGGCGGCCA
RBd08E10 pGCAP10 GAGGCGCGTCCTCCCGCGCGCTATGACGGCCAGCGCACAGCCGCGCGGGCGGCGGCCAGG
RBd96E08 pGCAP10 GAGGCGCGTCCTCCCGCGCGCTATGACGGCCAGCGCACAGCCGCGCGGGCGGCGGCCAGG
RBdS007L17 pGCAP10 CGGCCGGCCGATGACTTCCTGCCGCTGCCAGGCGCGTCCTCCCGCGCGCTATGACGGCCA
RBdS104M18 pGCAP10 GAGNNNCGTCCTCCCGCGCGCTATGACGGCCAGCGCACAGCCGCGCGGGCGGCGGCCAGG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl