Prev. |  KEGG KO K03574 > 

RIKEN DNA Bank Human Resource - NUDT15

Gene ID NCBI Gene 55270 |  KEGG hsa:55270
Gene Symbol NUDT15
Protein Name nudix hydrolase 15
Synonyms MTH2|NUDT15D
Ortholog resource in our bank

  NUDT15

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX055626 IRAK139B02 pCMV-SPORT6 BC064607 NM_018283 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR346124 RBb65F04 pGCAP1 NM_018283.1  
TGGAGGCGCGTCCTCCCGTGCGCTATGACGGCCAGCGCACAGCCGCGCGGGCGGCGGCCA
HKR363306 RBd08E10 pGCAP10 NM_018283.1  
GAGGCGCGTCCTCCCGCGCGCTATGACGGCCAGCGCACAGCCGCGCGGGCGGCGGCCAGG
HKR398504 RBd96E08 pGCAP10 NM_018283.1  
GAGGCGCGTCCTCCCGCGCGCTATGACGGCCAGCGCACAGCCGCGCGGGCGGCGGCCAGG
HKR403081 RBdS007L17 pGCAP10 NM_018283.1  
CGGCCGGCCGATGACTTCCTGCCGCTGCCAGGCGCGTCCTCCCGCGCGCTATGACGGCCA
HKR441906 RBdS104M18 pGCAP10 NM_018283.1  
GAGNNNCGTCCTCCCGCGCGCTATGACGGCCAGCGCACAGCCGCGCGGGCGGCGGCCAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl