Prev. | Human A to Z list > N > 

RIKEN DNA Bank Human Resource - NUDT15

Gene ID (NCBI) 55270
Gene Symbol NUDT15
Protein Name nudix (nucleoside diphosphate linked moiety X)-type motif 15
Synonyms MTH2|RP11-90M2.1
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K03574)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX055626 IRAK139B02 pCMV-SPORT6 BC064607 NM_018283 Partial

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR363306 RBd08E10 pGCAP10 NM_018283.1  
GAGGCGCGTCCTCCCGCGCGCTATGACGGCCAGCGCACAGCCGCGCGGGCGGCGGCCAGG
HKR346124 RBb65F04 pGCAP1 NM_018283.1  
TGGAGGCGCGTCCTCCCGTGCGCTATGACGGCCAGCGCACAGCCGCGCGGGCGGCGGCCA
HKR398504 RBd96E08 pGCAP10 NM_018283.1  
GAGGCGCGTCCTCCCGCGCGCTATGACGGCCAGCGCACAGCCGCGCGGGCGGCGGCCAGG
HKR403081 RBdS007L17 pGCAP10 NM_018283.1  
CGGCCGGCCGATGACTTCCTGCCGCTGCCAGGCGCGTCCTCCCGCGCGCTATGACGGCCA
HKR441906 RBdS104M18 pGCAP10 NM_018283.1  
GAGNNNCGTCCTCCCGCGCGCTATGACGGCCAGCGCACAGCCGCGCGGGCGGCGGCCAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl