Prev. | NRCD Clone T | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04214

HP ID(1) HP04214
Gene ID(2) 10641
Gene Symbol finder TUSC4
Protein Name tumor suppressor candidate 4
RefSeq NM_006545.4
Length of RefSeq (bp) 1672
Chromosome 3p21.3
Reference DDBJ accession
UniGene Hs.437083

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS187B05 pGCAP10 GGGGATTGGCAAGCTTGCGTGCCCCAGCGACACAGGCCTCGAGGCTGTCTCTGACAAGTG

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl