Prev. |  KEGG KO K20405 > 

RIKEN DNA Bank Human Resource - NPRL2

Gene ID NCBI Gene 10641 |  KEGG hsa:10641
Gene Symbol NPRL2
Protein Name NPR2 like, GATOR1 complex subunit
Synonyms FFEVF2|NPR2|NPR2L|TUSC4
Ortholog resource in our bank

  NPRL2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX039320 IRAK098E24 pCMV-SPORT6 BC050412 NM_006545 Partial/var
HGX047678 IRAK119D06 pCMV-SPORT6 BC063030 NM_006545 Partial/var
HGX047924 IRAK119N12 pCMV-SPORT6 BC056861 NM_006545 Full
HGY093145 IRAL032O09 pDNR-LIB BC021984 NM_006545 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR474829 RBdS187B05 pGCAP10 NM_006545.4  
GGGGATTGGCAAGCTTGCGTGCCCCAGCGACACAGGCCTCGAGGCTGTCTCTGACAAGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl