Prev. | NRCD Clone B | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04174

HP ID(1) HP04174
Gene ID(2) 274
Gene Symbol finder BIN1
Protein Name bridging integrator 1
RefSeq NM_004305.2
Length of RefSeq (bp) 2210
Chromosome 2q14
Reference DDBJ accession
UniGene Hs.193163

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARa74D11 pKA1U5 GGGCTGTCGGGCTGCGCGGCGTTGGNAGCGGCAGCCGGTTNTGGACGCGCGGCCGGGGCT
RBd07C12 pGCAP10 AGTTGGCTCCGCTGTCGGGTGCGCGGCGTGGAGCGGCAGCCGGTCTGGACGCGCGGCCGG
RBd78A04 pGCAP10 GGGGCGGGGGGCGCCGACCGCGGCCTGAGGCCCGGCCCCTCCCCTCTCCCTCCCTCTGTC

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl