DNA Bank Top |  KEGG KO K12562 > 

RIKEN DNA Bank Human Resource - BIN1

Gene ID NCBI Gene 274 |  KEGG hsa:274
Gene Symbol BIN1
Protein Name bridging integrator 1
Synonyms AMPH2|AMPHL|CNM2|SH3P9
Featured content Endocytosis (human)

Link

Ortholog resource in our bank

  BIN1

External database

human BIN1

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB07005 pCMFlag_hsBIN1 Expression vector of human BIN1.    
RDB04708 pAxCALNLhBin1(reverse) Shuttle vector to generate rAd expressing human BIN1    
RDB04705 pAxCALNLhBin1(reverse) Shuttle vector to generate rAd expressing human BIN1    
RDB04702 pAxCALNLhBin1(forward) Shuttle vector to generate rAd expressing human BIN1    
RDB04701 pAxCALNLhBin1(forward) Shuttle vector to generate rAd expressing human BIN1    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY085857 IRAL014K17 pOTB7 BC004101 NM_139350 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE032337 W01A080O01 pENTR-TOPO IRAL014K17 BC004101 NM_139350  
HGE032345 W01A080O09 pENTR-TOPO IRAL014K17 BC004101 NM_139350  
HGE032347 W01A080O11 pENTR-TOPO IRAL014K17 BC004101 NM_139350  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR029683 ARa74D11 pKA1U5 NM_004305.2  
GGGCTGTCGGGCTGCGCGGCGTTGGNAGCGGCAGCCGGTTNTGGACGCGCGGCCGGGGCT
HKR362860 RBd07C12 pGCAP10 NM_004305.2  
AGTTGGCTCCGCTGTCGGGTGCGCGGCGTGGAGCGGCAGCCGGTCTGGACGCGCGGCCGG
HKR391204 RBd78A04 pGCAP10 NM_004305.2  
GGGGCGGGGGGCGCCGACCGCGGCCTGAGGCCCGGCCCCTCCCCTCTCCCTCCCTCTGTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

2025.03.19

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl