Prev. | NRCD Clone Y | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04171

HP ID(1) HP04171
Gene ID(2) 150223
Gene Symbol finder YDJC
Protein Name YdjC homolog (bacterial)
RefSeq NM_001017964.1
Length of RefSeq (bp) 1350
Chromosome 22q11.21
Reference DDBJ accession
UniGene Hs.355952

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
RBdS007N13 pGCAP10 TGGGGGAGCGCGAGCGGTGGACCCAGGCGGCCATGTCCCGCCCTCGCATGCGCCTGGTGG
RBdS014B20 pGCAP10 GGGGAGCGCGAGCGGTGGACCCAGGCGGCCATGTCCCGCCCTCGCATGCGCCTGGTGGTC
RBdS105M20 pGCAP10 GGCATGCGCCTGGTGGTCACCGCGGACGACTTTGGTTACTGCCCGCGACGCGATGAGGGT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl