Prev. | 

RIKEN DNA Bank Human Resource - YDJC

Gene ID NCBI Gene 150223 |  KEGG hsa:150223
Gene Symbol YDJC
Protein Name YdjC chitooligosaccharide deacetylase homolog
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX046235 IRAK115J19 pCMV-SPORT6 BC053663 NM_001017965 Full
HGY053290 IRAK133D18 pBluescript BC057814 NM_001017965 Full/var
HGX055721 IRAK139F01 pCMV-SPORT6 BC064568 NM_001017965 Partial
HGY095800 IRAL039I08 pOTB7 BC017281 NM_001017965 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR403125 RBdS007N13 pGCAP10 NM_001017964.1  
TGGGGGAGCGCGAGCGGTGGACCCAGGCGGCCATGTCCCGCCCTCGCATGCGCCTGGTGG
HKR405644 RBdS014B20 pGCAP10 NM_001017964.1  
GGGGAGCGCGAGCGGTGGACCCAGGCGGCCATGTCCCGCCCTCGCATGCGCCTGGTGGTC
HKR442308 RBdS105M20 pGCAP10 NM_001017964.1  
GGCATGCGCCTGGTGGTCACCGCGGACGACTTTGGTTACTGCCCGCGACGCGATGAGGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl