Prev. | NRCD Clone B | Human A to Z list 
Available from Riken BioResource Center.

NRCD Human cDNA Clone - HP04134

HP ID(1) HP04134
Gene ID(2) 25805
Gene Symbol finder BAMBI
Protein Name BMP and activin membrane-bound inhibitor homolog (Xenopus laevis)
RefSeq NM_012342.2
Length of RefSeq (bp) 1732
Chromosome 10p12.3-p11.2
Reference DDBJ accession
UniGene Hs.533336

Click finder to find other clones.
(1) ID of gene defined by the depositor.
(2) ID of gene defined by the NCBI.

Clone ID Vector Accession No. 5'-terminal sequence
ARe69G05 pKA1U5 GGCTGGCNCGGGCGGGAGCTGCGGCGGATACCCTTNCGNTGCTGTGNAGACCCTACTCTC
ARf03B05 pKA1U5 GGCTGGCGCGGGCGGGAGCTGCGGCGGATACCCTTGCGTGCTGTGGAGACCCTACTCTCT
ARiS055L17 pGCAP10 GGGGCTGGCGCGGGCGGGAGCTGCGGCGGATACCCTTGCGTGCTGTGGAGACCCTACTCT
ARiS087F07 pGCAP10 GGCTGGCNCGGGCGGNAGCTGCNGCGGATACCCTTGCGTGCTGTGGAGACCCTACTCTCT
ARiS191H23 pGCAP10 GGCTGGCGCGGGCGGGAGCTGCGGCGGATACCCTTGCGTGCTGTGGAGACCCTACTCTCT

2012.10.24

NRCDhumgene.csv - NRCDhumclone.csv - Kato_HPxxxxxx_html.pl