DNA Bank Top |  KEGG KO K10162 > 

RIKEN DNA Bank Human Resource - BAMBI

Gene ID NCBI Gene 25805 |  KEGG hsa:25805
Gene Symbol BAMBI
Protein Name BMP and activin membrane bound inhibitor
Synonyms NMA
Featured content Wnt signaling pathway (human)

Link

Ortholog resource in our bank

  BAMBI

External database

human BAMBI

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB04195 Ax3hBAMBI Recombinant adenovirus expressing human BAMBI    
RDB04194 pAx3hBAMBI Shuttle vector to generate rAd expressing human BAMBI    
RDB04193 pCAhBAMBI Expression vector of human BAMBI    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082732 IRAL006N20 pOTB7 BC019252 NM_012342 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE037483 W01A093L19 pENTR-TOPO IRAL006N20 BC019252 NM_012342  
HGE037487 W01A093L23 pENTR-TOPO IRAL006N20 BC019252 NM_012342  
HGE037517 W01A093N05 pENTR-TOPO IRAL006N20 BC019252 NM_012342  
HGE037521 W01A093N09 pENTR-TOPO IRAL006N20 BC019252 NM_012342  
HGE045690 W01A114D18 pENTR-TOPO IRAL006N20 BC019252 NM_012342  
HGE045694 W01A114D22 pENTR-TOPO IRAL006N20 BC019252 NM_012342  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR067749 ARe69G05 pKA1U5 NM_012342.2  
GGCTGGCNCGGGCGGGAGCTGCGGCGGATACCCTTNCGNTGCTGTGNAGACCCTACTCTC
HKR081229 ARf03B05 pKA1U5 NM_012342.2  
GGCTGGCGCGGGCGGGAGCTGCGGCGGATACCCTTGCGTGCTGTGGAGACCCTACTCTCT
HKR222281 ARiS055L17 pGCAP10 NM_012342.2  
GGGGCTGGCGCGGGCGGGAGCTGCGGCGGATACCCTTGCGTGCTGTGGAGACCCTACTCT
HKR234927 ARiS087F07 pGCAP10 NM_012342.2  
GGCTGGCNCGGGCGGNAGCTGCNGCGGATACCCTTGCGTGCTGTGGAGACCCTACTCTCT
HKR276591 ARiS191H23 pGCAP10 NM_012342.2  
GGCTGGCGCGGGCGGGAGCTGCGGCGGATACCCTTGCGTGCTGTGGAGACCCTACTCTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

2024.10.02

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl